The PKC-activating phorbol ester PDBu (1 m), delivered via the recording pipette, did not detectably alter the paired-pulse ratio [PPR; control, PPR at 0 min, 2

The PKC-activating phorbol ester PDBu (1 m), delivered via the recording pipette, did not detectably alter the paired-pulse ratio [PPR; control, PPR at 0 min, 2.17 0.32; PPR at 5C10 min, 2.31 0.28; scrambled, PPR at 0 min, 2.50 0.39, Fig. of NR1, NR2, and NR3 subunits, which cotranslationally assemble in the endoplasmic reticulum (ER) to form functional channels with differing physiological and pharmacological properties (Wenthold et al., 2003; Prez-Ota?o and Ehlers, 2005; Lau and Zukin, 2007). NMDAR-mediated Ca2+ influx is essential for synaptogenesis, experience-dependent synaptic remodeling, and long-lasting changes in synaptic efficacy such as long-term potentiation (LTP) and depression (LTD), cellular processes widely believed to underlie learning and memory (Collingridge et al., 2004; Malenka and Bear, 2004). Recent studies indicate that NMDARs serve not only as a trigger of synaptic plasticity, but may also contribute to the expression of LTP and LTD (Lau and Zukin, 2007). PKC plays a critical role in memory formation and storage (Wang et al., 2006), induction of LTP (Ben-Ari et al., 1992), and vesicular exocytosis (Morgan et al., 2005). PKC increases NMDAR channel opening rate in oocytes and promotes NMDAR insertion at the cell surface via SNARE-dependent exocytosis (Lan et al., 2001a). PKC phosphorylates NR1 at Ser890 and Ser896 near an RXR ER retention motif and promotes NMDAR forward trafficking (Scott et al., 2001, 2003). Although NMDARs are a known functional target of PKC potentiation, the direct molecular target of PKC phosphorylation is unclear. Target PKC and PKA phosphorylation sites have been identified on the NR1, NR2A, and NR2B subunits (Leonard and Hell, 1997; Tingley et al., 1997). However, NMDARs assembled from mutant subunits lacking all known sites of PKC phosphorylation show marked PKC potentiation (Zheng et al., 1999; but see Liao et al., 2001), suggesting that the molecular target of PKC is a receptor-associated signaling and/or trafficking protein. Emerging evidence indicates a role for the SNARE family of membrane fusion Berbamine proteins in trafficking of postsynaptic glutamate receptors (Lledo et al., 1998; Lan et al., 2001a; Lu et al., 2001; Washbourne et al., 2004). Rabbit Polyclonal to HP1alpha The transcription of mRNA. WT and 20 (dominant-negative) mutant constructs of SNAP-25 in pcDNA3 were gifts from Dr. Roger Y. Tsien (Howard Hughes Medical Institute, University of California, San Diego, CA). SNAP-25 constructs were linearized at the 3 end with EcoRI. Capped mRNAs were synthesized as runoff transcripts from linearized plasmid cDNAs with T7 polymerase (mMessage mMachine transcription kit; Ambion; 2 h at 37C). Mutagenesis. The SNAP-25 protein sequence harbors 3 sites that conform to the PKC consensus phosphorylation motif (S/T-X-R/K): Ser28, Thr29 and Ser187. These residues in SNAP-25 were mutated into Ala or Asp by Berbamine site-directed mutagenesis, singly or altogether using the QuikChange XL Site-Directed Mutagenesis Kit according to the manufacturer’s protocol (Stratagene). The mutagenic primer sequences for the S187A mutation were (5 to 3): GATCATGGAGAAGGCTGACGCCAACAAAACCAGAATTG and CAATTCTGGTTTTGTTGGCGTCAGC CTTCTCCATGATC; for S187D were GATCATGGAGAAGGCTGACGACAACAAAACCAGAATT GATG and CATCAATTCTGGTTTTGTTGTCGTCAGCCTTCTCCATGATC; for S28AT29A were GGCTGATGAGTCCCTCGAGGCCGCCCGTCGCATGCTGC and GCAGCATGCGACGGGCGGC CTCGAGGGACTCATCAGCC. Introduction Berbamine of an XhoI site (underlined) in the S28AT29A primers allowed fast screening of the mutant by restriction digest. Subcloning. For transfection into HEK-293 cells and neurons in culture, WT and mutant SNAP-25 cDNAs were subcloned into the pIRES2-EGFP vector (BD Biosciences Clontech), which allows production of a single bicistronic mRNA containing SNAP-25 and EGFP. SNAP-25 cDNAs were excised from pcDNA3 with BamHI (5) and EcoRI (3), and pIRES2-EGFP was cut with BglII (5) and EcoRI (3) enzymes and the 5 end Berbamine dephosphorylated by CIAP. The fragments were ligated together overnight at 16C using T4 ligase (Promega) or Quick Ligation kit (New England Biolabs) at a molar ratio of 1 1:3 (vector:insert). The final constructs and orientation of.